Monthly Archives: August 2012

how to sequence the shRNA constructs?

It is very difficult to sequence the shRNA constructs due to the hairpin structure. However, you can use the DNA relaxation agents in the sequencing reaction (0.83 M Betaine, Sigma #B-0300), plus 1x PCRx Enhancer [in Invitrogen kit part # 11495-017]), which may be helpful.

Sequencing primers for OriGene Hush constructs:

forward primer is located at the 5′ of the cloning site (around ~188bp), and has the sequence  5` ACGATACAAGGCTGTTAGAGAG 3`.

reverse primer is ~70bp downstream of the last T of the 6T terminator. And the sequence is 5′-TTGAGATGCATGCTTTGCATAC-3′.

7,000 Purified Human Proteins from HEK293 Cells

UltraMAB™, the Ultra Specific IHC Antibodies

Are you sure that your IHC signals are truly specific?
High specificity is the pre-requisite for IHC antibody to be used for diagnostic and therapeutic applications. The cross-reactivity may potentially cause unexpected side effects and false diagnostic reports for clinicians. However the validation tools for antibody specificity are lacking. Although research data from various groups has shown that some monoclonal antibodies on the market are not mono-specific, it remains a challenge to produce the truly mono-specific antibodies to replace them.
OriGene is proud to announce that we have developed a high density protein microarray chip for antibody specificity testing. With the world’s largest collection of overexpression protein lysates, OriGene is in the unique position to produce a high density chip of human proteins. This protein chip is spotted with 10,464 (10K) unique over-expressed proteins in duplicate on a single nitrocellulose coated glass slide. This protein microarray technology has been used to validate the specificity of an existing ERCC1 diagnostic monoclonal antibody, and has been applied as a screening method to identify the most specific UltraMAB™ monoclonal antibody for this target.
The excision repair cross-complementation group 1 (ERCC1) protein is an important biomarker for clinicians to predict whether certain patient populations with non-small cell lung carcinoma will respond to cisplatin chemotherapy. As such, it is critical to develop highly-specific immunohistochemistry validated monoclonal antibodies for this diagnostic test. Several publications revealed that 8F1, the most commonly used antibody clone for ERCC1, exhibits cross-reactivity to an unknown protein in ERCC1 deficient cell lines. By using OriGene’s high-density protein microarray technology, the corresponding cross-reactive binding protein for 8F1 monoclonal antibody was identified. This technology also enable us successfully develop the most specific UltraMAB™ monoclonal antibody for ERCC1 (4F9). This data was further confirmed by western blot analysis.

Flow Cytometry for Intracellular Staining

  • Solutions and Reagents
    1. 1X Phosphate Buffered Saline (PBS): Dissolve 8g NaCl, 0.2g KCl, 1.15g Na2HPO4 and 0.2g KH2PO4 in 800mL distilled water (dH2O). Adjust the pH to 7.4 with HCl and the volume to 1 liter. Store at room temperature.
    2. Fixation buffer: 2% paraformaldehyde in 1xPBS
    3. Permeabilization buffer : 0.1% Triton X-100 in 1xPBS
    4. FACS buffer: 0.5% BSA , 0.05% Azide in 1xPBS
    5. Fluorescent dye conjugated secondary antibody.
  • Fixation
    1. Collect cells by centrifugation and aspirate supernatant.
    2. Fix the cell by 125μl cold fixation buffer, vortex briefly.
    3. Incubate at room temperature for at least 30 min or for 1hr 40C.
    4. Centrifuge for 5min at 300g,remove the supernatant.
  • Permeabilization
    1. Add 1ml permeabilization buffer to each tube.
    2. Centrifuge briefly, and aspirate supernatant.
    3. Resuspend cells in 125μl of permeabilization buffer and incubate at room temperature for 5min.
  • Staining
    1. Aliquot 1-2×106 cells into each tube.
    2. Add 1 ml FACS buffer to each tube, centrifuge to pellet the cells.
    3. Resuspend cell pellet with 125μl FACS buffer containing diluted primary antibody, vortex and incubate on ice for 30min.
    4. Rinse as before in FACS buffer by centrifugation.
    5. Resuspend cells in fluorescent dye conjugated secondary antibody, diluted in FACS buffer per manufacturer’s recommendations.
    6. Incubate for 30 minutes on ice.
    7. Rinse the cells as before in FACS Buffer by centrifugation.
    8. Resuspend cells in 0.5 ml PBS and analyze on flow cytometer