Category Archives: Technical Tips

It is not necessary to linearize a plasmid before stable transfection. Linearize the plasmid will increase the chances of correct integration, but also reduces the transfection efficiency. So in the end, there is no big difference between these two methods.

There are four sites in pCMV6-Entry than can be used to move the insert of a TrueORF clone into any of Gateway’s entry vectors (pENTR-1A, -2B, -3C, -4, and -11).  These sites are BamH I and Kpn I (5′ end) and Not I and Xho I (3′ end).  BamH I, Kpn I, and Not I will preserve the frame of the ORF; Xho I will not, and should only be used to transfer clones that will not be tagged at the 3’ end.

It is very difficult to sequence the shRNA constructs due to the hairpin structure. However, you can use the DNA relaxation agents in the sequencing reaction (0.83 M Betaine, Sigma #B-0300), plus 1x PCRx Enhancer [in Invitrogen kit part # 11495-017]), which may be helpful.

Sequencing primers for OriGene Hush constructs:

forward primer is located at the 5′ of the cloning site (around ~188bp), and has the sequence  5` ACGATACAAGGCTGTTAGAGAG 3`.

reverse primer is ~70bp downstream of the last T of the 6T terminator. And the sequence is 5′-TTGAGATGCATGCTTTGCATAC-3′.

Finding a right clone from OriGene website sometimes can be very confusing. The best way to do this is to search the clone via NCBI reference number. So before you start looking through OriGene website, go to NCBI website first.
http://www.ncbi.nlm.nih.gov/

Pick up the option “Gene” and put your gene name (e.g. human p53) in the box, click “Search”.

Normally you will see a list of relevant genes on the next page.  Choose the correct one and click on the link. You can find the reference number (e.g. NM_000546 for p53 isoform a) from the next page. It should be in the “mRNA and Protein(s)” section.
You can search all the OriGene products related to your gene by the NCBI reference number.