Western Blot Protocols

Western blot analysis
  1. Run SDS-PAGE gel, and then Western transfer the protein samples to nitrocellulose (NC) membrane for immunoblot analysis.
  2. After transfer, transfer the membrane to western-blot tray, briefly wash the NC membrane with distilled water.
  3. (Optional) Visualize the proteins on the membrane by Ponceau’s staining.
  4. Wash off the red stain with distilled water.
  5. Block the membrane with 5-10ml blocking buffer (made by 5% non-fat milk in 1xPBST) for 30 minutes at R/T.
  6. Dilute the primary antibody with blocking buffer according to the suggested dilution factor on datasheet (In case of anti-DDK mouse monoclonal antibody (TA100011, do 1:4000 dilution).
  7. Remove the blocking buffer and add enough diluted primary antibody to cover the membrane.
  8. Incubate the membrane with primary antibody for 1hr at R/T. (Note: Or you can do overnight incubation at 4C, make sure you cover the western-blot tray to prevent excessive evaporation). To prevent uneven coverage, the western-blot tray can be rocked on a rocker platform.
  9. Collect the primary antibody and store them at 4C for up to two weeks. (If you would like to store them longer, you can freeze the diluted antibody at –20C. Remember frequent freezing and thawing will gradually decrease the antibody titer.)
  10. Briefly wash the membrane with 1xPBST once to remove any excessive primary antibody.
  11. Add enough 1xPBST to cover the membrane and leave the Western-blotting tray on a rocker platform.
  12. Wash the membrane for 15 minutes. (Note: If the background is high, repeat this step for two to three times.), turn on the developer during the wash time.
  13. Dilute HRP-conjugated secondary antibody with blocking buffer (1:5000 or higher dilution is usually good for Goat anti-mouse-HRP; TA100015).
  14. Incubate the membrane with secondary antibody for 30 minutes to 1hr.
  15. Wash the membrane with 1xPBST for 15 minutes, and then 3 times (5 min/time).
  16. Prepare the chemiluminescence development substrate mixture by mixing equal amount of solution 1 and 2 (TA100016; Normally 1ml will be enough for one membrane).
  17. Prepare a plastic saran film, lay the film on a flat surface, and dispense 1ml of substrate mixture for one membrane on the plastic saran film.
  18. Use a forceps to take washed the blot from the western-blotting tray, flip it, lay on the substrate mixture, and then incubate for 1 to 5 minutes. (Note: To avoid air bubbles, always lay the blot by touching one edge first.)
  19. Remove excess Chemiluminescence Reagent and wrap the membrane in plastic. Place inside X-ray cassette.
  20. Expose to film and develop
Buffer preparation
1xPBS: This buffer is made by dissolving 8g of NaCl, 0.2g of KCl, 1.44g of Na2HPO4 and 0.24g of KH2PO4 into 800ml of distilled water. Then adjust the pH to 7.4 with HCl, and add H2O to 1 liter.
1xPBST: 0.05% Tween 20 in 1xPBS

What sites should I use to transfer a TrueORF clone into the Gateway system?

There are four sites in pCMV6-Entry than can be used to move the insert of a TrueORF clone into any of Gateway’s entry vectors (pENTR-1A, -2B, -3C, -4, and -11).  These sites are BamH I and Kpn I (5′ end) and Not I and Xho I (3′ end).  BamH I, Kpn I, and Not I will preserve the frame of the ORF; Xho I will not, and should only be used to transfer clones that will not be tagged at the 3’ end.

how to sequence the shRNA constructs?

It is very difficult to sequence the shRNA constructs due to the hairpin structure. However, you can use the DNA relaxation agents in the sequencing reaction (0.83 M Betaine, Sigma #B-0300), plus 1x PCRx Enhancer [in Invitrogen kit part # 11495-017]), which may be helpful.

Sequencing primers for OriGene Hush constructs:

forward primer is located at the 5′ of the cloning site (around ~188bp), and has the sequence  5` ACGATACAAGGCTGTTAGAGAG 3`.

reverse primer is ~70bp downstream of the last T of the 6T terminator. And the sequence is 5′-TTGAGATGCATGCTTTGCATAC-3′.

7,000 Purified Human Proteins from HEK293 Cells

UltraMAB™, the Ultra Specific IHC Antibodies

Are you sure that your IHC signals are truly specific?
High specificity is the pre-requisite for IHC antibody to be used for diagnostic and therapeutic applications. The cross-reactivity may potentially cause unexpected side effects and false diagnostic reports for clinicians. However the validation tools for antibody specificity are lacking. Although research data from various groups has shown that some monoclonal antibodies on the market are not mono-specific, it remains a challenge to produce the truly mono-specific antibodies to replace them.
OriGene is proud to announce that we have developed a high density protein microarray chip for antibody specificity testing. With the world’s largest collection of overexpression protein lysates, OriGene is in the unique position to produce a high density chip of human proteins. This protein chip is spotted with 10,464 (10K) unique over-expressed proteins in duplicate on a single nitrocellulose coated glass slide. This protein microarray technology has been used to validate the specificity of an existing ERCC1 diagnostic monoclonal antibody, and has been applied as a screening method to identify the most specific UltraMAB™ monoclonal antibody for this target.
The excision repair cross-complementation group 1 (ERCC1) protein is an important biomarker for clinicians to predict whether certain patient populations with non-small cell lung carcinoma will respond to cisplatin chemotherapy. As such, it is critical to develop highly-specific immunohistochemistry validated monoclonal antibodies for this diagnostic test. Several publications revealed that 8F1, the most commonly used antibody clone for ERCC1, exhibits cross-reactivity to an unknown protein in ERCC1 deficient cell lines. By using OriGene’s high-density protein microarray technology, the corresponding cross-reactive binding protein for 8F1 monoclonal antibody was identified. This technology also enable us successfully develop the most specific UltraMAB™ monoclonal antibody for ERCC1 (4F9). This data was further confirmed by western blot analysis.

Flow Cytometry for Intracellular Staining

  • Solutions and Reagents
    1. 1X Phosphate Buffered Saline (PBS): Dissolve 8g NaCl, 0.2g KCl, 1.15g Na2HPO4 and 0.2g KH2PO4 in 800mL distilled water (dH2O). Adjust the pH to 7.4 with HCl and the volume to 1 liter. Store at room temperature.
    2. Fixation buffer: 2% paraformaldehyde in 1xPBS
    3. Permeabilization buffer : 0.1% Triton X-100 in 1xPBS
    4. FACS buffer: 0.5% BSA , 0.05% Azide in 1xPBS
    5. Fluorescent dye conjugated secondary antibody.
  • Fixation
    1. Collect cells by centrifugation and aspirate supernatant.
    2. Fix the cell by 125μl cold fixation buffer, vortex briefly.
    3. Incubate at room temperature for at least 30 min or for 1hr 40C.
    4. Centrifuge for 5min at 300g,remove the supernatant.
  • Permeabilization
    1. Add 1ml permeabilization buffer to each tube.
    2. Centrifuge briefly, and aspirate supernatant.
    3. Resuspend cells in 125μl of permeabilization buffer and incubate at room temperature for 5min.
  • Staining
    1. Aliquot 1-2×106 cells into each tube.
    2. Add 1 ml FACS buffer to each tube, centrifuge to pellet the cells.
    3. Resuspend cell pellet with 125μl FACS buffer containing diluted primary antibody, vortex and incubate on ice for 30min.
    4. Rinse as before in FACS buffer by centrifugation.
    5. Resuspend cells in fluorescent dye conjugated secondary antibody, diluted in FACS buffer per manufacturer’s recommendations.
    6. Incubate for 30 minutes on ice.
    7. Rinse the cells as before in FACS Buffer by centrifugation.
    8. Resuspend cells in 0.5 ml PBS and analyze on flow cytometer

How to find your cDNA clone from OriGene website?

Finding a right clone from OriGene website sometimes can be very confusing. The best way to do this is to search the clone via NCBI reference number. So before you start looking through OriGene website, go to NCBI website first. http://www.ncbi.nlm.nih.gov/
Pick up the option “Gene” and put your gene name (e.g. human p53) in the box, click “Search”.


Normally you will see a list of relevant genes on the next page.  Choose the correct one and click on the link. You can find the reference number (e.g. NM_000546 for p53 isoform a) from the next page. It should be in the “mRNA and Protein(s)” section.
You can search all the OriGene products related to your gene by the NCBI reference number.